EST 419177 is a singleton


Sequence

>419177 (1 EST) Length=233 CTAAACTTCTTTCAGAATGNAAGTTTGGAAAATGNATTACCCTGTTTTCAATTTCTACCGACATGAATTCATCTATCTTT TTCAATTTAAAAAGAGTAATATTTATTCATCATTGTTGACAATTTGTATTTTTATCTATTATGTGACTTTATCCTATTAT TCGGTTTTTCTTATCTCATCATTACCTTTTACACCTTGGTGTTAATCCCACAAAACTTGGTATTACATCTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419177: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191771128028N21895SMNHADA019055SKSmAW


Date: 13:49:30 on Thu 23 Nov 117.