EST 419181 is a singleton


Sequence

>419181 (1 EST) Length=326 CGTAAGTTATGATGAACCAATATTTAGATATATTGAAATGATCGAAAATCAGTATACTTCTTGGTAATTGTGAAAACAAC TTGGANGAAGGAATGTTTACCTGGTAAAGGTTTCGGTTGGAAAACGTTTGCAGTTGCTGTGAATGCAAATTGTACCGTTT GGAAATTTCACTCATTCAACCGAATTGATTGCATTAACAAATCATTTACAGTGTGGGATGTCAACCACGCTGCAGGTAAT CGACTATGTATTCCCTCCGTTGGAAATTTATTATTGCACACAATTTTCAAGATTGGTGCATGTTGTATGGTCAAACCCGA AATGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419181: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191811128032N21899SMNHADA019060SKSmAW


Date: 14:1:50 on Fri 17 Nov 117.