EST 419182 is a singleton


Sequence

>419182 (1 EST) Length=326 CAAAACACGCAGCATCAATCAAGNAAAAAACATTTGCTAAGCTTTGGAACTTGTATCGGTCGCTTCTCAAAAACAGGCAA CTTTAGACTCCACATAACCGCTCTCGACTTCTTATCACCGTATGCCATGTTTCGTGTATGGTTAAAAGCATCTGCTGAAC AACAGTTTCTTTACGGACAAAATGTNTNGGCGGATCAGGTATCGCTAAGATGTCGGGACAACACTCCGCAGGTATACCGG TGTTGGTGGTGATGAACATGAGTGATATGCCTCTAGGGTTTCGGGGGTGGCTGCCAAGTCATCTCTGCAAGGTAAAAAAC ACTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419182: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191821128033N21900SMNHADA019067SKSmAW


Date: 8:50:32 on Fri 24 Nov 117.