EST 419183 is a singleton


Sequence

>419183 (1 EST) Length=287 GAGCTAGGAGCTCAAATCCATGTAGACGAGAAGNAATGAACGCTACATCGTTAATGGTGCTCATCAAGCAGATAAATTGC AGGAACTATTAGATGGCTTCATTAAGAAGTTTGTGTTGTGCCAAAGCTGCGGGAATCCGGAGACTACCATGCACGTCAAC AAACGAGGAGGTACAGTTGCTACAACATGTAAAGCATGTGGAAGTCAGGGACAACTGGACGGTTACTCACAGGGCTGACC CAGTATNTTGTCAAAANCCCTCCAGGAACCAGAAGCTACTCCGGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419183: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191831128034N21901SMNHADA019069SKSmAW


Date: 23:37:22 on Fri 17 Nov 117.