EST 419187 is a singleton


Sequence

>419187 (1 EST) Length=225 ACTGGGAGGNTGGTGTTNCCATCAATCCGANTNTAGATAGATTTAGTTATATATAAATNTAAGTATACATTNGNATAAAA CACCAANGTNGTCTAATTCTAAAACAGGAAATGTGTTAGAAAATCCCCTTTNGGGAGTTGTGAAAATAACTTGCATGATT NTGGATGAAGTTAACGGTTCAGTACATACACTCGATTTACAGGAAATAAAAACCCATATCATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419187: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191871128038N21905SMNHADA019074SKSmAW


Date: 4:13:16 on Wed 22 Nov 117.