EST 419190 is a singleton


Sequence

>419190 (1 EST) Length=508 AGGGTGGACGTGGATTCCCTTTAACTTACTTATCTGGAGGGAACTTTCTCCATCGCCCCTTCATAGATGTTCCTGCCTTA CAGATGACCACATCATGGTTCACGATGCAAAATGTTTTTAATTCAAGATTTTGCCAAATTATGGAGCGTGACTTCTTCCG CTGTGTTGCAAGAGTTGGCATTCAAAATACAGACAAACATTGCAAAATATACTGGGAAGATTTGCTTGAATGTCAGAATC ATGATAAAGCTAAAAAAAGAGCTATGATGATGGAAAAAGTTAGAAAGGTAAAGAAAATGGAGCCGATGGCCACTCTACCA TACAGNGCGTTTAAAGACTGCAACTTCTGATGACAATTGACTTTCCGTGTTCATTTCCAATCACATTTATAAATGACAGG TNGGTGGTAGTGTAGATCTTACATCTCTAATCTTGTGACTAGTAGGANTTTGGNCTTGATTTTAACTATTGGCCTCAAAA ATTGGGGTGGGGGTGGTCCACCGTACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419190: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191901128041N21908SMNHADA019079SKSmAW


Date: 22:8:8 on Sat 18 Nov 117.