EST 419192 is a singleton


Sequence

>419192 (1 EST) Length=190 ATAATGGTCCATGGNGATTGATTGGAACAAGGTTGGAGGAGATGGTATTCTTTGGTTCATCGATTGGNCAATGAAATGTC CAGAACAATTATGTTAAAACTTTATTCAGTGTTTCAATAACTTAATCGGAAACTGACTAGTCTATCATTCCTTATCAATC CTGTNTTTTGTAAAATATAGTTTAGTTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 419192: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191921128043N21910SMNHADA019084SKSmAW


Date: 6:0:30 on Wed 22 Nov 117.