EST 419198 is a singleton


Sequence

>419198 (1 EST) Length=285 CTGGTTAATGTTCAAAGTGAATGTATGGATTNNCTTATATNCATNGGTATAATTTATCTAGTATTAAAATAATTGGTGGA TAGGTAATTTATGGCATTGGATTTCANGTTTCTTTATTTATATGATGGNCTATGAATGATATGGGAAAGAAAAGAGAAAG ATTGGTCAAGTGAAAACTGGTTATNGATGTTGGTGNNTTGGGNTANTATTATGGATGTAANTTCATTCCCCCTCTACTAT CCACTGGTTAAAGCTTGGATTACGATAAAATGACCTATTTCAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419198: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191981128049N21916SMNHADA020002SKSmAW


Date: 2:44:10 on Fri 24 Nov 117.