EST 419203 is a singleton


Sequence

>419203 (1 EST) Length=426 TAATAAAACATAAACGGGATTCAGTGTGAAACCAGTCAACTAGNAATCGCGTTTTCAGGAAGAGAACGAAACTCTTGTGG CGATCCCTTACAGTAACATTCAGTTCAAAACTATGAATTGGNCAATACTTGGACGACATTCAACAAAACTGTTCGTTTTC TTCAACTGTCTTTTCATTACATTTGGCATTATTGTGATTGCATTCGGTATGAAACTACCAACCAAACTATTTAGATATAA GAGGATATTGCAAGCAACCATACCTCCCATCTTTCCAACTGCTACTTTCTCAGGAAGTCTCAGTATATTAGCTACATGTA TTGGAATATTAGGAATATNGAATGAAAGAAACATGATTATGTATCTGCATCTGTGTACTTGGACTATGGTGATGATCACC GAAATAGGCATAGCATCATCATCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419203: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192031128054N21921SMNHADA020012SKSmAW


Date: 4:21:29 on Fri 24 Nov 117.