EST 419204 is a singleton


Sequence

>419204 (1 EST) Length=399 ATAAGTTACAAGNGAGGTCACATGGNGATCGNCATCATCACGAGCATCACCAGCAACAAAANTCTTCTAAGCATACTTCA TCGAAACACTCTGAAATGCCATCGGATAGAATTTCCAAACATTCTGATCCAGCACGTAAAGATGATAAAAGGTCTCGTTT AAAAACTCGTCCTGTGGATACTCCATTTTTTAATGATACACCCAATTCGNCTGCCCATTCACGTCAAATAAAAATGAGAG TGAAATAACTGTCTTTTATTGATATTTTNACAGGTCCTATATTTGGTACAAAAAATTGTATAATTATTTATAAAGATATC TTTTTCATTGGGTTCTTATCATTTGGTGGCATCCAGCAAAAACCAATCGTCGNTTTTTTTAATAGAATNTATCTCCGNG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419204: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192041128055N21922SMNHADA020013SKSmAW


Date: 2:46:57 on Mon 20 Nov 117.