EST 419206 is a singleton


Sequence

>419206 (1 EST) Length=284 GTTGTATTTGGTTCTGGACTGTACCTTTATGGATTATATTAAGCATGAATTATATTTATACATGGTATATGGAAACATTA ATTCGTATTATAGATGAATTCATTCATTTTGGGTGGATTTATCATTATGATGGTTTTCTTAAGGCCAGATAAAACAAATA TCATATTCCCATATCATACTAGTTCAATTTCAACAATCCCATCTATAAAGCAAGATGATAATGATAATTGGAAAACAAAA CTAGTCACTGAAACTGTTAGTAGTACATCANCAGCANNANCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419206: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192061128057N21924SMNHADA020016SKSmAW


Date: 3:59:36 on Thu 23 Nov 117.