EST 419209 is a singleton


Sequence

>419209 (1 EST) Length=59 AGAATACCATACTTGATGGGGGCCTCTCAATTCCACTAAGTGATACATTGNTATTGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419209: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192091128060N21927SMNHADA020020SKSmAW


Date: 16:31:1 on Mon 20 Nov 117.