EST 419214 is a singleton


Sequence

>419214 (1 EST) Length=136 TGTTTNGATTGGTTTATTTATAATCTGNCTTATTCATTGNTTTNCAATGCATCNAACTCACTTTTCTACATTGTTTCTAT GTTGTACCATAGAGTACTAACTAAACTGTACAAGTAAAGAAATGAATGAAACCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419214: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192141128065N21932SMNHADA020038SKSmAW


Date: 2:48:25 on Sat 25 Nov 117.