EST 419217 is a singleton


Sequence

>419217 (1 EST) Length=384 ATTATGATTTGTATTATTACCACTATTTTTATTCATATTTTACCACAACTAGTTGTTTATCACCTTTAAAACATATTTTT TATGTAACTCAATTTATTGAGTGTTTTGGTTTAATTTTGTCGGNAGTTGTCAATGGATCATCAAACACCAGGGGAACAAC ACCATGAGTGTCACTAACAACAACAACAACAAGAGGAAATGTATTGAGTTATTGTTAATTGTTCTTGTGATATCTGTCTC TGTGATGCTTNNNATTTCTATTTGGTTATATAATGTATAAATAAGTTNGGAATGCTTGGAAANGTTCTTTATTTNATATT TGGAATAAGTTCGGTTTGGATGTATTGNTCANTCCGAAATATTTTGGAATAATNATTTAGGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419217: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192171128068N21935SMNHADA020041SKSmAW


Date: 13:1:5 on Sun 19 Nov 117.