EST 419220 is a singleton


Sequence

>419220 (1 EST) Length=404 AGTTCGGAANCAATTGGAATGTAAAGAATAATATGGATAATGATTTNGAGTCAGCTTTTGGGTCAGGACGTTCCATATCT AAATATAAACACATAAAAGCTAGAGCTNACGATGCAAAAGGGAAATTTCAATCACGTGGGAACTAGAGGTTATGGTATGG TCTCCTCAGAATCCTCACAATTTTTAATTGAAGAGACTTTGGNTAAATATGGTCGACCAAAACCTATTAAATCGAAATTC AAAACTCGTGGGAAAAAAAAGAANTATTCTAAAAAAATTGTTGATNATCANTTCGACATTAAAGGTGGTTTATTTGANGG ACATAANTATAAACAAACTGGTGATTATCAAGCAANTGGTACTCATGTTTACATCAATGTGCGAAATGAACAATGAGATG GATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 419220: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192201128071N21938SMNHADA020045SKSmAW


Date: 19:16:23 on Wed 22 Nov 117.