EST 419223 is a singleton


Sequence

>419223 (1 EST) Length=259 TAATCATCCTCATCTNCAGNATCATCATTATGGTACATCATTAATTATAACTCATGATAAATATACATCTATTATAAATG GTAAAAGGAAAACAGATGAAGATGGAATTATTGATGCCAAGGAATATGATGATGATGACGATGTTCAAAATTTGAAATTT GATAAACATCCATATGGTTTATTCAGTNTCCCATTTACAATTTTTGATAAACTTGGTTTTGGTGGATTGTTTTGAGAGAA TATACGTTGAAATTCAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419223: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192231128074N21941SMNHADA020053SKSmAW


Date: 12:3:36 on Fri 24 Nov 117.