EST 419228 is a singleton


Sequence

>419228 (1 EST) Length=447 GTGTCTGCAGNGTAATTTGTACTATCTTCTATATGCTATATATCAGATGTAAATTGTGTTATAAATTCTCATCTNGTGTT CTNAATTGATTACGCTCTCGTATAATTAGGAGTCTTTCTATTCAATGTAGGTGAAAATTACTGTTATATTTAGTTTTTAT TAAGCAAAGAATAAGGAACCATACTTTTTAAATTTTTTTGGATCCTGATCCTCCTAAAATATTCCATCATTCCTTATTTT CAGGAACCAGCATTGAAAGTACTTATTCTGATAAAGAGGATAAAACTGATGATATTGGCACGCTCTCGAATCTGTCAAGG AATGTTGGATATTANCACAACGGATACAACTCACCTGTTTATGGAGGTCGNTAAAAACCGAGGCTAAATATCTCATATGN GACAATTTCATAACAAATCANATCTGTNTTCAATNTCTATTTTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419228: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192281128079N21946SMNHADA020060SKSmAW


Date: 4:27:27 on Fri 24 Nov 117.