EST 419231 is a singleton


Sequence

>419231 (1 EST) Length=482 GCTCGTCTAGCTNNAACGTNTAAAACGAATTCGTCAGAAAGCAGAAGGTATATCTGATGAAATACCAGAAACTGAAAAGT GGCAGCAAATAAAGCAGCTATATAAGAAAGCTGGNCTGTTGAAAAGGAAGCGTCGTCCTCTTCATGTAGTTGTGAATACA AAAGCTGGTTCGCGTAGCGGGGGCACCAAACCTCAAAAAGGGGCTAAAATCAAAATCGTAGATAAACGAATGAAAGCAGA TTTACGTGGACAGCAAAAAGCTAAAGATGGAAAAAAACATGGAAAGCGTAAGAATAAAGTGGGACGTCCTGGAAGACCGA AAAGTCGAGGAATCGGGAAGAGACGTTAACTGTTCTGTTCCGNTTATTGCGANCTGTATNTATGATCCATTGGATTATAT TGATTCCTGTAAAATATCAGATAATTTCTAACTATTACAATAATTCCATGTGGGTACTAATCCANAATGAGGATTTTGGG CG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419231: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192311128082N21949SMNHADA020066SKSmAW


Date: 7:4:37 on Mon 20 Nov 117.