EST 419232 is a singleton


Sequence

>419232 (1 EST) Length=434 AAANCTTAACTGGTTTCAAATGGTTGGNTAATCGNTCATGTGAGNTAGAATCGCAAAATATTAAAACANTTTTCGCTTTC GAAGAAGCTATAGGTTTTATGTGCGGTGATGTTGTCTGGGATAAAGACGGTGTTGGNGCTTTAGCAGTTATGGCTGAACT GACTGCTTATGTTCATCGTAATGGGAAATTATTATCCGAGCAATTAATAGAGATTTATNNCATTTATGGTCAACATATNT CCAATAACGGTTATTACTTTTGGTCANGANCCGGAAAAAATCGTTAAGATGTTCAATCGCATACGTAATTGGCCTAATGA ACCTGGTCCTAAAGGTTATCCCCANAAACTTGGTCGGTTTCAAATAACTGGTATNCGGGATTTAACAGGTGGGCTATGAT GANCATTATCCCAGGNTTTAAGGCCGGTTTACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419232: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192321128083N21950SMNHADA020068SKSmAW


Date: 2:37:58 on Fri 24 Nov 117.