EST 419233 is a singleton


Sequence

>419233 (1 EST) Length=444 GGTTCNAAAGTAACTTTACTTACTGGTGGATACTACACTCTACCGTTACTGTTCTCCGCAGTTCANGGGAAAACAAGCTA CTGGGAACATGCTGCTGGTTGGGGAATTACAAGTTCATGGTATTGCTTAAATCGTGGATTTAAGCGAATGCTTATAGCAG GAATGATTGGTTCTGTACCTGGTCTGCTTACTGGTGTTTTATCCATGTTAGCATGTCGTATGTCAAATTCAACATTTGAG GAATTATACGCGAAACATTTAAATGAAACTCAGAAAATCTAACTGTTAGCACTTCGCATTTATTTNTTTTACATAAAATC ATTCTCTAGTGTGTNTCATNGTGGAACTAATTATTTTCGAATCATATGTGGAACATTCAANTGTNTTTATCCTATTAAGT CATGTTACTATTATNTAGATAGGATTAAATGTGCGGNGGCTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419233: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192331128084N21951SMNHADA020070SKSmAW


Date: 17:42:44 on Mon 20 Nov 117.