EST 419235 is a singleton


Sequence

>419235 (1 EST) Length=210 TACAAGAATAAATTTNGGGAAAAATGTGGGTAAAGAAGAAAAATAACTGCAGTTTCGATTGACAATTGNATGTGACAAGT TAGAGCGGTGAATTTTATTTTTCCACATTTACTTCGATTTTGTGGGACAATTGTTCATAAATTCCTTACATGGACTTGCT TAATGACTATCATGTGGTTTGGCACTAAATACATATATGCGGTTACATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419235: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192351128086N21953SMNHADA020073SKSmAW


Date: 1:46:21 on Sun 19 Nov 117.