EST 419237 is a singleton


Sequence

>419237 (1 EST) Length=398 AGATCATATACAGATTATAAAAGACCGGTAATTACCCTACCACTTTCTNGTAAAACAGGCAATTCAATTCATCCAAAAGG TTGTGCTGAAGCCCTATATGATTATATACAACATGTATCATGATAATAATATATATATGCATGCATTCGCTATCATTAAA GCTATCTATTTGGCACTTCTATTCTTCTATATCGTAAATCTGAGAAGAATAATTTATCTGTATAAATCTGTNTNNCCGGG GGGGTGGGCCGGACTCAAATGATGAAGATGTTGGTTGATGTCGCTAAATCTGAACTATATACTTCATATATTGACTAATT GNGTAACACAAATCGATGATTATTGAACTAATTAAGGGAATATAATATTACTCANCAATATGCTATTCATTNCACTTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419237: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192371128088N21955SMNHADA020077SKSmAW


Date: 12:49:51 on Sat 18 Nov 117.