EST 419242 is a singleton


Sequence

>419242 (1 EST) Length=504 TACTAAACAAAATTAAGATTTAGTATCTAGTACTGTGATCTGTGGTTTTAGGAGAATAGTATTTAGTTCATATGCTAAAA TATTGCACTTGCACATTTTTATGTTACATCTGTCTCATCATTATCATCGAGGCAAGAACAAGAACAAAGGATTATGATAA AAATTGGGGCGTAAAAGCAGTAACAAGACTGTGTGGTATGGAAGGAGAGGAATGCATGGATGATTTCAATTGTTGTGANG AGTATGAATGCAGCCCTGATTTGCAATGTCAACTTAGGAATGCTAGAAATAAAATTGCTGGATCTTACCGAAATNTATGT GTAGCTGATTATGATTGNCTACCAGGATGGTGTGGTGAAGGCAAACTATATGCACGTCGCTGTACACAAGATGGTAATAG AAAAACTGAACCAGATGTGGTCCAGCTGGAGGTTATTATGGACGACAATTTGGCATCTTGGGCACACAAACGNCATTTGG TCGNANCATATGGACATTATGGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419242: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192421128093N21960SMNHADA020084SKSmAW


Date: 14:8:26 on Sat 18 Nov 117.