EST 419245 is a singleton


Sequence

>419245 (1 EST) Length=98 AATAATAAGGATGAGGCTGGTGAGGATGATGAAAAGGGGGGTTGATAAAAATATTGAAAACTTTNTAATAAATCAAGAAA ATATAAAAAATAAAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419245: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192451128096N21963SMNHADA020095SKSmAW


Date: 16:55:7 on Wed 22 Nov 117.