EST 419247 is a singleton


Sequence

>419247 (1 EST) Length=412 AGATATNATGATGNCANTATAGNTATGGTNACGAAAGTGTACAGATTCGAGCAATTAATCAAATACTATAANTGANTATA NTANAACCTATCTGCTTCTTATTAATAAAANGTGATGAAAAGATATGAACAGTACATNATTGAAATCAAACGTCTTCATA AGTTCACGACCCAATTTTCACATATTTAATCATATGAAAAATGAATTTNATTTCTATGATTCATTATGTATTTGGATTCA GCCTTTNNTATATTATTATATTTNNAAAAAATAATAATACCCATGATTATTTTTATATTTTTGGGTTAATAAATCATTAC TAATTAAAAATGCTACATAATACACATGTGAGATAGATGCATTTTACATCCATAGGTGGGTATCATTACATGTTATAAAT TACCATTTCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419247: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192471128098N21965SMNHADA020067SKSmAW


Date: 0:50:32 on Fri 24 Nov 117.