EST 419249 is a singleton


Sequence

>419249 (1 EST) Length=291 GCAGNGTCTTCTGAAGCATGCACGATTAGACTTCCANGAACCTTTGGAGCGGATGGGTTTCGTCTGCCAATTCTACATCA TGCTGTTCGATTGGGTGACTATAATGCTCCAAATTACTCTTGGAATATGGTTTGAATCCTCTCGTATGTGNTGGTATTGG CAACANAGTNACACAGNATTCATNGTGAAGATACATACAATGTGCATTCGTTTACATCTAATCCAAATAATCAGAAATCT ATATTACTATGGTTCAAACATTTCACGGTAGTGAGATCATATTACTGCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419249: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192491128100N21967SMNHADA020087SKSmAW


Date: 21:50:0 on Fri 17 Nov 117.