EST 419250 is a singleton


Sequence

>419250 (1 EST) Length=410 CAGTGNTTNCCAGTTCTGTGATTCTCTCTTTACAACCTTTTCTGTTTTCTAAAATCCATGACCCGAAGGTATTTTGTTTC TCTCTCTTGGTTGNCCTGTTGTTCTCCCTTTCTACTCCGCTCTTGCTACATCTTCTGACTTCCAGTCATGTTACTGAATT ATATTATGACAAGGAAAACAAAAAGTTCACTGCTTGTCTAAAAGGAATACTTCTGAATACCAAGAAATTGGAGTTCACTG CTGAAGATGTCAAATACATCCAGCCGACTATTACAATGGCAAGCATTATGGNCAAAGGTGTACCGTTATTTGTTTCAGAA GATCACTTCAAAGATATTGAAGTGTATAAACAATTAGNGCGGGNCAATGAACCATGGAATGTAAAGAAATTCTGAATAAA TATTGGGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419250: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192501128101N21837SMNHADA007024SKSmAW


Date: 12:42:26 on Sun 19 Nov 117.