EST 423610 is a singleton


Sequence

>423610 (1 EST) Length=113 TTTGTTTTAGTCTATTTTCATAAAACACTGTTGATTTATTTTGTTTCATTTTCTTGGATCAATCTATGATGATCATATTT AAATAGTCTGGTTACTGTATGTTTTAAGTATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 423610: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236101139711N25363EST000464S. mansoni cDNA


Date: 19:6:20 on Thu 23 Nov 117.