EST 423611 is a singleton


Sequence

>423611 (1 EST) Length=172 AAATCAACTGATATGCCAGAATCAATGCAATGTATAGCGGTTGATTGTTGTGCAGCAGCATGTCAACGTTTTAAAGATGA TAGAGATATAGCTAAATATATTAAACAAGAATTTGATAAACGTTATGGTGGAACATTGCAATGTATAGTTGGAAAACGTT TTTGGTTGTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 423611: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236111139712N25364EST000465S. mansoni cDNA


Date: 17:26:26 on Wed 22 Nov 117.