EST 423615 is a singleton


Sequence

>423615 (1 EST) Length=141 AGGCTTTTTTGTTTGTTCTGTCCGTTTTATTTATTAAAGCTTCTTTTGTCATGAATAATTAAACTTAATAAAATATGAAT CGTTAATATCGATGTAGCTTGTCCATTGTTACTTTCCTTTTTTGGTTCTGGCTCTTTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 423615: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236151139716N25368EST000478S. mansoni cDNA


Date: 6:6:28 on Sun 19 Nov 117.