EST 423617 is a singleton


Sequence

>423617 (1 EST) Length=240 GAGAGTTGTCATTGGAAATTAGCCCAATGTGTGATCGTGAATCGGTAGAAGTTGAAAAGTCTCAGGTTAGCTTCATTGAT TTTGTGTGTCACCCATTATGGGAAACATGGTGTGATCTAGTACACCCCTGTGCTCAATTAATTCTAGATACATTGGAAGA TAATCAGGTGACTGGTATGAATGTCATATAAAAGAATCCAAAATGAAAGTTACTCAGTTAGCTCGACCAAAATTAGCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 423617: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236171139718N25370EST000480S. mansoni cDNA


Date: 9:18:22 on Sat 18 Nov 117.