EST 423619 is a singleton


Sequence

>423619 (1 EST) Length=250 TTTCAGTATATATGACCAAGAAAGTCTAAATCATGCTCCGTGGTTAACTGACTGGCCTGAACCTATATGGGTTACATTAC AACAAAATGGTGGCTATGCTGGTTCAATTTTATGGCCTTTAACTGATCAGTTTGTTAGCGATGATTTACCATTTCAACGA GTTTCACAATATGCTTTACTTAATGACTATGAACACCGTTATGCATATGATCAACGAATCAGAGATATATATGGTGGTTA AAATCCTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 423619: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236191139720N25372EST000483S. mansoni cDNA


Date: 12:15:52 on Mon 20 Nov 117.