EST 423625 is a singleton


Sequence

>423625 (1 EST) Length=101 CACGAGTGAAGCCTGATCTAAATGACTATTTTTGAATATTTTCTTGATTAATATAGTTTTACATGGTGTGTGCATTTTTG CCACATTCCTGAATTTCCGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 423625: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236251139726N25378EST000525S. mansoni cDNA


Date: 14:40:34 on Fri 17 Nov 117.