EST 423628 is a singleton


Sequence

>423628 (1 EST) Length=216 CGAGAAAATGTATGTACATCGAGTGATTTTATCCGATTTAATTGCTGGCACAATTTATTATTATAAATGTGGTAGTTTAG ATGGTTGGTCAGATGTTTTAAATTTTCGTGCCCCCTGCCCATCTCATCCTTATGGACCCTAAACTAGCATGCTATGGAGA ATGGGACGAACTGATCGCATTTGACTACCAGAATTAATTTCATCAATCGAAAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 423628: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236281139729N25381EST000531S. mansoni cDNA


Date: 5:0:45 on Tue 21 Nov 117.