EST 423630 is a singleton


Sequence

>423630 (1 EST) Length=88 CGGAAAATTACCGAATAATCATTGATACTGTCCGAATAATTGTTCCATTGAAAAACAGATTCGCTTATTTCTGGAACCGG TTCTGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 423630: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236301139731N25383EST000534S. mansoni cDNA


Date: 4:27:8 on Wed 22 Nov 117.