EST 423632 is a singleton


Sequence

>423632 (1 EST) Length=110 ATGCTAAAGTCTTCCTTACTTGCATCGGATTTACATAACTATGGGTCATACAAATTTTAACACATATGTTAAGATAGGAT GCCGTAGGACAAAAACGTCCCATAGAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 423632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236321139733N25385EST000540S. mansoni cDNA


Date: 16:56:1 on Wed 22 Nov 117.