EST 423633 is a singleton


Sequence

>423633 (1 EST) Length=120 GTATCTTGTTCACCGGTGTTGTATTAACACAACTGAGTGATGTAGCGACAGACGAAAAAACGAAAAAATGTTGCGTAAAA TAGTATCTACAAGCGGACAATCTTCATGTGATGGCAGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 423633: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236331139734N25386EST000541S. mansoni cDNA


Date: 18:55:3 on Thu 23 Nov 117.