EST 425554 is a singleton


Sequence

>425554 (1 EST) Length=412 GAAAAATATGTTTTGTTCTGCACTGTATTATTTTCATATTTTATAGTTATCAAGTGTGAGACGTGAACCTGGTGTTGGTT GTGATTCACCTGACTTACCGTCCTATGAGGTAGCATTCAGTAAAGAGAAAGCGCAACGTCGAGTTGAAGAGGAAGAGGAA AGGGACGTAAAGCAGATATAGCAAATACTATTGCTCTCGAAGGGATTAAAGTAACTTTTGATCAGCTTTCTTTGGATTGC GATAAAGCAATCGATCCTGCTCTGTTTGATGATTCACCTGAAGCGACTGATTCAGGTGCAGGTAAAGATGGAACTCTCGG TTCTGGTGTTATATTACTTGCGCAACAGATGATTCTTAGTCAGGGGAAATTGAAACAAAATAAAAGCGTTAGGTAAAACT ACATTTTAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 425554: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4255541141655N27307SWMFCA225SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:46:21 on Sat 25 Nov 117.