EST 425560 is a singleton


Sequence

>425560 (1 EST) Length=301 CAAGTTAGAANTTTTCCCATGCCAACATTTACCAAGAATTCTTCCATACTTACCTGATATCTTACTCTTCGTTGATTTTT AATTGTATATTCAGGTAACATTTTACAATGCTAATAGCAATATTTTTATCTGAGAATAAATATTTTCAATAATGTCTGAT GTAGTTTCTTTTTTTNNCCGTTTGGAATAAAAAAATTTCCACGGNGGGGTTGGGGGGTTTAANCTGATTTAGGGTAATAG ATGTATGGCTGAAATATGGAGTTAAAAAAATGGGCTCTTAAGGGTTTTCCTAGACTCCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 425560: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4255601141661N27313SWMFCA232SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:50:8 on Tue 21 Nov 117.