EST 429167 is a singleton


Sequence

>429167 (1 EST) Length=99 CAATTAGTTATATCTCTACGGTTACTAGATTTTCACATTTCCTTAAAACTGTCACAATAATCAACTCTAGTAGAATCTAT GACATGACAGTCTTTTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 429167: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291671145893N28037EST000163S. mansoni cDNA


Date: 5:4:48 on Sat 18 Nov 117.