EST 429168 is a singleton


Sequence

>429168 (1 EST) Length=81 TTGGCTATACTTTACCTTATAAACACTATGTACACTATCTATACTACTCTACATCAGAATAGCAGGCATAAGAGGACAGG A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 429168: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291681145894N28038EST000171S. mansoni cDNA


Date: 20:48:53 on Sun 19 Nov 117.