EST 429175 is a singleton


Sequence

>429175 (1 EST) Length=114 GATTGGGATTTTTATGCAATACCATTTTTAACAGGATTATTATTGTTATTCTTGTTTTATATTAGACATAGAAGGGTTTA AAATTATTGTTTCTGTGTGTAATTTTTTCTGTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 429175: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291751145901N28045EST000276S. mansoni cDNA


Date: 14:24:28 on Sat 18 Nov 117.