EST 429176 is a singleton


Sequence

>429176 (1 EST) Length=215 ATGTGTTGTTGAATTACCCGACTATGAACCATTTACTGTAATGTACCCTCGTACAATCAATTGGCATCAAGTTGTTCCGA AAATGTCATTTCGTGGTCGTGATTTATTACAACAACTTGTTGTCTGTAATCCAGCAGATCGAATGTCAGCTGATCAAGCA TTAAAACATTCATATTTGAGAGTATTCTGTGATATTAATAAAGAAATTCTGCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 429176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291761145902N28046EST000281S. mansoni cDNA


Date: 19:24:24 on Sun 19 Nov 117.