EST 429178 is a singleton


Sequence

>429178 (1 EST) Length=212 TTTTATTTATGTGGAGTTTCTGAAGTTTTAATCTATTTGTTTTTATGTTTAGTGTTGATGATTGGTTTAGTATTTATAAA TTTTATTGTTGGGTTTTCTATTAGTAGATATTTTCGTTAATCACAATTAAAAAAAAAAAAAAAAAACTCGAGGGGGGGCC CGGTACCCAATTCGCCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 429178: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291781145904N28048EST000285S. mansoni cDNA


Date: 2:33:18 on Sat 25 Nov 117.