EST 429180 is a singleton


Sequence

>429180 (1 EST) Length=139 TGCTATGGACGAAAGGCAAGCACTAAAAGTTCGTACTTCTTCAGAAAAGTAAACAGAATCCAATTTGAATAAAATTTCAC ACGACACTAAGTAAAAATTTTTATTATGTTTGAGAAAAATATATTTCTAGTGTTATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 429180: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291801145906N28050EST000287S. mansoni cDNA


Date: 22:3:3 on Fri 17 Nov 117.