EST 429191 is a singleton


Sequence

>429191 (1 EST) Length=323 GGGCNANGCTCGNANTTAACCCTCACTAAAGGGAACAANNANCTGGAGCTCCACCGCGGTGGCGGCCGCTCTTAGAACTA GTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGGAAANGTGTTAGCCAAGAAAATTCAACCAGANTTAACAACCAATG AAGTGATCACTAGTCATGACTCTTCAACAAATGGATTAATTGCATTTATTAAAAATCATCGAAAATAAAATCATCTTTGC CGAACGAAGAAAAAGGGAAAGACAACCGGGNATTNTTAATAGGTTCAATCGTAATCGTAATGACAATTTTNGTGANTAAN NTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 429191: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291911145917N28061EST00012S. mansoni cDNA


Date: 17:23:39 on Wed 22 Nov 117.