EST 435002 is a singleton


Sequence

>435002 (1 EST) Length=255 ATCTCTATGTAGCTGNTTTGTGNTATACTTNNCAGACCTCTGTATCTCAATTTAGCTTTTTCATCGTTTGNCATATTTTC ATTCTTGACCGATTTGTTTGATTCTAAGGGATTCATTGTTTTCCAGCACATAAACGTTCTACAAGTCCTGCTTTTTACAC TTGTCACTTGNAACTATTGCCTTGNTGGATTAAAATAGCTTATTTCATCGATCAAGCCACATGTACATTGCAAATGATAA TTATTTTCAGATAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 435002: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350021154026N33627SMNHADA002009SKSmAW


Date: 19:42:55 on Fri 17 Nov 117.