EST 435006 is a singleton


Sequence

>435006 (1 EST) Length=400 TTATCGATGATTTNGTNGAGACAAATTATTTTNGNATCACAAACTGGTATCAATCATAGAAACTTNTNGGAACTAGGTGT GGATATTAAGCTATTTAAGCTAATTCANTTTAGGCCTAATCGACATTCTGCACTCACTATCTCACACATAAACAACCCCC TCAAAACCCGAATTCCGCTGNCAAATAGCAACTAAATCCGTNTTCACTGATGGATATTTTCATCTATCTCAGTGGCTGTA TGATTTNATTCAAGTTTCAACCCAATATTGNNCTGGGTCTGCATGGTGGNTTTCCAAAGTCTATAACAAAACAGCTCTAC AATCCATCGTNGCTTACAATGGNTCTCCTGCTTATATCCACACTATGAACTGTCTTCGAACTGGACGAATCTCCATGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 435006: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350061154030N33631SMNHADA007002SKSmAW


Date: 10:7:1 on Wed 22 Nov 117.