EST 435018 is a singleton


Sequence

>435018 (1 EST) Length=280 TTGGATATGAGCGATAATCAATGTTTAACATTTATTAGTGGAACAGTATGGAGGTATGATAAATTATTAGATTAAATTGT TACTAGCTCATGTTGCAAGAGTGANCTGCGATTAGGGGCTCCAGAAGAGAGAATGCAGTAATAAAGAACAATGAGTTGTG ATATTTATCAAGGTGGAGTATGTTCCATCGAAGGAGGGAAGTCAGGATTGGNACGATGAAGAACAGAGCAGTGCATATAG AGAGTAGTGTTTAAGTAAAATAGCAACCATATCCTTTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 435018: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350181154042N33643SMNHADA008003SKSmAW


Date: 9:11:4 on Sat 18 Nov 117.