EST 435021 is a singleton


Sequence

>435021 (1 EST) Length=360 ATTAAGTANTTGGGTTCGTCAATNTCCTCGTATTCCACATTTCATCAAAGAGAGTTGGTTAACTGNAATGTATTATGCAA AGACAGTTGGTGNTCAGAATTGTACTCATTTGANTGATATAAACTAAATACACAATCCTTTCATGCTNTTCACTCAGTTT NGGGAGTGAAACGGTAGCTTAGTGGCTAGACCACTTGTGTTTCCATCCGAATAGGTCACAGATCCAAACTTCACCTCANC NTTACTTCGGTTTGGAGCGGGCAAGTAATNGTCGCTAATCCTTACACAAATTATGTGGGGCTCAAGGTTGGGTGAGTACA TTAAACCTGTACTTGGGTAAGATGAGCTCTATTGCATATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 435021: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350211154045N33646SMNHADA008023SKSmAW


Date: 10:46:19 on Tue 21 Nov 117.